Targeted disruption of the murine SST3 and SST4 genes. A , Targeting strategy for disruption of the SST3 gene. A 427 bp SacI–SalI fragment from the middle of the coding region for SST3 is deleted and replaced by a neo cassette (white box). The neo cassette is flanked 5′ by 1.7 kb and 3′ by 6.5 kb of genomic sequence from the SST3 locus. B , A 592 bp SacI-HincII fragment covering most of the coding region for SST4 is deleted and replaced by a neo cassette (white box). The neo cassette is flanked 5′ by 6.7 kb and 3′ by a 1.1 kb of genomic sequence from the SST4 locus. C , Southern blot analysis of mouse tail DNA from wild-type (1) and SST3 KO mice (2). DNA was digested with XbaI and subjected to hybridization using a genomic probe (XbaI-SacI fragment). The expected increase of fragment size in the mutant (from 6.5 to 7.7 kb) is depicted schematically and shown in the autoradiograph. D , Southern blot analysis of mouse tail DNA from wild-type (1) and SST4 KO mice (1). DNA was digested with HindIII and subjected to hybridization using a genomic probe (HincII fragment). The expected decrease of fragment size in the mutant (from 6.7 to 3.8 kb) is depicted schematically and shown in the autoradiograph. MB4, 5′ TCCACACCCTAACTGACACAC; MB5, 5′ ATCCAGGAAACCAGCAGCGGCTAT.
