Table 8.
List of primers used for allele specific quantification of HAB and LAB alleles in F1 offspring of rats and mice
| Species, gene, specificity | Orientation | Primer sequence (5′ → 3′) |
|---|---|---|
| Rat, Npsr1, common | (+) | ACTGTGGCCAGACGACTCCT |
| Rat, Npsr1, rHAB-specific | (−) | CCTCGGTTGTAGCTGCAGCATATC |
| Rat, Npsr1, rLAB-specific | (−) | CCTCGGTTGTAGCTGCAGCATACT |
| Mouse, Npsr1, common | (+) | GTGCTGTTCTCCACGTGCAG |
| Mouse, Npsr1, mLAB-specific | (−) | TCAGGGGCCATGAAGTCTCGT |
| Mouse, Npsr1, mHAB-specific | (−) | TCAGGGGCCATGAAGTCTCGC |
